Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig29
Contig Information
Length 1166 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9n16    rwhms9n16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195625724|gb|ACG34692.1| hypothetical protein [Zea mays]
Score 1422
Evalue 2.34848e-155
Total Hit Count 80
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig29
TCGGCGCCGCCAAGGATACAACCAGCGTGAGCACAAAGCCTACAAGGAGGTACCCGCTCGCGTCATGGGTTGCCATACTGGCCCTGGCCACCCTTGTGGG
CGTATACATATTCTCCTTATCTCTCAAGCAAAACGGGATGCTGTTCGGGCTCAGGCAGACCAACATGATAGAGAAAGAAAGGGAGCAGCCTTGCCACCAC
CCGGGAGTTCCGGAGACCGAGATCCCTTACGTGCACTTCCCCACACCCAATACTTATAGTAGGAAAGAATGTGCATGCACACCAGTTAGATTCTTTGCTA
TCTTGTCGATGCAGAGGTCGGGAAGTGGATGGTTTGAAACCTTGTTGAATAGCCACGAGAATATTAGCTCAAATGGAGAGATTTTCTCTGTCAAAGACAG
GCGTAGCAATGTCACGGCCATCACACAAACACTCGATAAATTGTACAATCTCGACTGGGTCAGCAGTGCCGCTAAAAATGAGTGCACGGCTGCTGTGGGG
TTGAAATGGATGCTCAATCAGGGTCTGATGAAACATCATCAAGAGATAGCTGAATATTTCAACCGAAGGGGTGTGTCTTTAATTTTCCTTTTAAGAAGAA
ACCTTCTGCAGCGATATGTCTCTATATTGGCAAATGATTATGATAGAAATACGAAGCAACTAAATGGAACTCACAAAGCTCATGTGCATCACAGAGGCCA
GGCTGATGTTCTTGCTCAGTATAAGCCAACAATAGACACAAAATCGTTGATTGCTGAACTGAAAAGGTCTGATAAGTTGGCAGCTGATGGTTTAGTGAGT
TTCAAGAAGATCCGGAGTATTGTCCTGTACTATGAGGATGTGGTCAGCAATCGCACTAAGCTTACAGATGTGCTGGATTTTCTGAAATTGCCAAAGATGA
AGCTATCCAGTCGGCATGTGAAAATCCATACTAAACGGTTGCGTGATCATATTGATAATTGGACTGATGTTTCTAATACTTTGAATGGGACTCAATACCA
GAGCTTCTTGAATGGTCGAAGATGACCAAATTAGCTAGGTGTAAATAATGTTGTAGTGAGTTTCATTCTTTTGACCCCTTCTTTCTCCCCTGCCATAGCT
AGCAGAGTAAGCCAAAGTTGGCACTTGTGTCCATCATGTGCTAATCCAAAGGGCTCATTGGTTCCA
page-top