Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig26
Contig Information
Length 849 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9i13    rwhms9i13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Endoplasmin homolog; AltName: Full=GRP94 homolog; Flags: Precursor >gi|22652|emb|CAA48143.1| GRP94 homologue [Hordeum vulgare]
Score 909
Evalue 4.3778e-96
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig26
TCATTCCTCGAGCAGCTAACCAAGAAAAACTACGAGGTTATCTACTTCACCGACCCCGTGGACGAGTACCTGATGCAATACCTCATGGACTACGAGGACA
AGAAGTTCCAGAACGTGTCCAAGGAGGGCCTGAAGCTGGGCAAGGACTCGAAGCTCAAGGACCTCAAGGAGTCGTTCAAGGAGCTGACGGACTGGTGGAA
GAAGGCCCTGGACACGGAGGGCATCGACTCGGTGAAGATCAGCAACCGGCTGCACAACACCCCCTGCGTGGTGGTCACCTCCAAGTACGGGTGGAGCTCC
AACATGGAGAAGATCATGCAGGCGCAGACCCTGTCGGACGCGAGCAAGCAGGCGTACATGCGCGGCAAGCGGGTCCTGGAGATCAACCCCAGGCACCCCA
TCATCAAGGAGCTCCGCGACAAGGTCGCCCAGGACAGTGACAGCGAGGGCCTGAAGCAGACGGCGAGGCTGGTGTACCAGACGGCGCTGATGGAGAGCGG
GTTCAACCTGCCGGATCCCAAGGACTTTGCGTCGAGCATCTACCGGTCGGTGCAGAAGAGCCTGGACCTGAGCCCCGATGCGGCCGTGGAGGAGGAAGAG
GAGGTGGAGGAGCCCGAGGTGGATGAGAAGGAGTCGGGCAAGGCGGAGGAGCCGGAGCACGAGCAGTACGACAAGGACGAGCTGTAGTTGCTGCGGTCTT
CTCATCGCCCATTTAGCTCTCAGTAGAACTGTTGGACTGGAAATGTGATGGTTTCGAGGGACGTCCATTTTTACCGCGCGAAAACGCAAATCATGGTGAT
ACGAGGTTTTTGTCAGTGTAACGTACTGTACCTAGTTTTGTTTTAAAGT
page-top