Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig25
Contig Information
Length 814 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9i01    rwhms9i01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative ZmEBE-1 protein [Oryza sativa Japonica Group]
Score 699
Evalue 9.03514e-72
Total Hit Count 262
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig25
TTCTGGATTAATCATGCCGGAGATGGTAAAAAATCAAGCTATAATGCGATTCAAGTTGGCTGGCATATTAATCCANATCGCTATGGCGACTCACATCCTC
ACTTCTACACCCGTTGGACGAGAGATAATTATGATGCAACTGGCTGCTACAACATGGATTGCCCTGGTTACACACGGGTAGATGGCGCTGTTATAGCTCC
GGGTGATGCTATACATCCAGTTTCTAATGTCCCTGATGGACCTAGACAATGTATCACTCTGAGGGTGCTAAAGGACAAAAAAAGTGGAGATTGGTGGGTG
TATTATGGCTTCAATAAAAGCCCCACAGGTGTGGGATACTTCCCAAGGTCGTTGTTCAGCTACTTAGCAGAAAAGGCAGACGGAATGCAATTTGGTGCAT
TTGTTCAAGCTAAAAAAGCACTTCCGACTCCTCCAATGGGCAGTGGTGCCCTCCCAAATGGTGGTAAGGGTCGNGCCGCATCATTCNCAGNCANTNGATT
CATTGNCCAGGATGGAAATAGCAGCCCGATCAAGGAAGACCTGCCCATGTTCGTTNNTGATAGAAAATGCCACGCTATCACCCATATTGATCATGCTGCA
TGCTATTATGGTGGTCCTGGAGGTTGTATGAGATAAGATGTGATNCTNTGAGCTTGGTATCNCTTAGTGTTNGTTGTCANATAAAATGGCANGGANGAAA
AAAANTATGAAGAGAGTATTCGCTTATTTACNTAAAGCTACNCTATGAAAACCTTTGCTTGCAACAAACATGCATCCCTTTTACTTAAATCGACCTAGCC
ATCGAATGGAATAC
page-top