Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig21
Contig Information
Length 299 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9i05    rwhms9i05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutaredoxin related protein [Oryza sativa (indica cultivar-group)]
Score 98
Evalue 0.0129975
Total Hit Count 21
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig21
AATGGGGGGCTGTGACATTGTTCTCGAGTTGAAAAAGAGTGGAGAGCTGAAGGCCACTCTCTCGGAGTAGCTGGTATTTTGGTGCTATATCGTTGTCTTA
TGGTGTTTCGAGCATCTGTCCTATATCGAATTGCTCTATTGATGGCATTGTTATGTCAATGTATCTCGTAGATCCATGTTTTAAACTTGGATATCCTAGT
GCTACGTTTGCTTGAACTGTGACAGCTGCAGAAGAAATAACTTATAAGACCTCTTAAGTGGCCTGTTAGTATTCTATCACCACTTCAATAAAAAAAAAA
page-top