Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig20
Contig Information
Length 1125 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9j06    rwhms9j06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0641600 [Oryza sativa (japonica cultivar-group)] >gi|33146643|dbj|BAC79973.1| unknown protein [Oryza sativa Japonica Group] >gi|113611966|dbj|BAF22344.1| Os07g0641600 [Oryza sativa (japonica cultivar-group)] >gi|215687155|dbj|BAG90925.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215707184|dbj|BAG93644.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218200106|gb|EEC82533.1| hypothetical protein OsI_27056 [Oryza sativa Indica Group]
Score 1007
Evalue 2.9491e-107
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig20
ATTTCCACCCTGCTGCTGCAGTCGCCGGCGGCGAGGAGGAGCTGAGAGATGGCGGACGCCGGCGGCGTGAGGGAGCGGGAGGAGGAAGAGGACGACGACT
TCGTCTGCCTGGATCCGTCCTTCTTCATGAATCGCAACTACGAGATGAAGACCTTCACCTACGGCTCCCAGGAGCTCCAACTCCTCTGCCTCAGCTCCGC
CTGCACTGATTATGATCTTACTGGACAGTTAGTATGGCCAGGTGCTGTTCTGATGAACACGTACCTATCTGAACACCCTGAGACTGTGAAGGGGTGTTCA
TTAATTGAGTTGGGATCTGGGATCGGCATTACCGGAATATTGTGCAGCCGTTTCTGCAAAGAGGTGGTATTGACTGATCACAATGATGAAGTTCTAGAGA
TTATAAAGAAAAATATAGAGATGCAGTCATGTTCTGGCAATGCGGATGCAGTGTTGACTGCTGAGAAGCTAGAATGGGGAAATCATGATCATCTAAGCAA
TATCATTGAAAAACATCCTGTTGGATTTGATCTCATTCTTGGAGCCGATATCTGCTTCCAGCAAGCTAGCATTCCATGTCTCTTTGATACTGTAGTGAAG
CTTCTTCGTATGCAGGCCAATAAATGTAGATTTATACTGGCTTATGTATCACGAACCAAAGTCATGGATGCACTAGTACTGAAGGAAGCTGAAAAACGTG
GAATGGTTGTCAAGGAAGTGGACGGGACAAGAACAACCATCACAGATCTCGAAGGCGTCATATTCGACATCACCCTCAAATGACGCCTCCGATGGAATGC
TTGGGTGACAATTCCATCAGACAGGAACAAGATGTGGAGCCTCCTATCAGGAAAGCCAATGTTACCGCCTGCATGATCTGCTGAGCTGGCCCTGAACATG
ATGTGGTCTCTAGTTTGCATCTCTCCACTCCATGGGAGAAAACAGTAGTACAACACTAGCATCAGTCCTGATATGGCGCTGATTGATTCAGCACAACTTT
TAAATGACTCGCCGGTCGTGGCCCTTTTCGCTAAATCAAGAAGCGATTCGGGTCACGACGTCACAGCGTTTTTCCTATACCGTCTATCAAGTACCAATGA
GATGACCAGGCACTGATGGAAGTCC
page-top