Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig19
Contig Information
Length 692 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9m16    rwhms9m16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit mCG114323, isoform CRA_b [Mus musculus]
Score 87
Evalue 0.613247
Total Hit Count 29
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig19
CCTTGATCTTATGATCGGACGATGGCGGCGCCTTGGTGTCGTTCTACCTTCTTGGGGGCTTCGTTTCGGAGCTCGGCATCTGCAAGCGGGACTAGTGGTT
GACGGCGGTTGTGGCGTCCAGGTTTCTGTGGCAACTATGATGGTGGGAGCGATGTCGGCGACGTGGCAATGGTTGAAGTAGTCGGCTCTTCTCCGGCGTG
TCCGCGTGTTTGCCTCGGTTTGTTTTGCTGTTGTGAAGTCGAAGCTGTAGCGGCGGGGCCCTGTGGTATACGATGACTGACTGCAGGCGAACCCTTCGGC
GATCTTCAGTGGCGCCAGCCGTGCTTGGTTTTGTCCTTCGTAGTTCTTCGTCAGAGTCGGAGTTGCGCTGTTTGGTCGCAGGTGGATGAGTTTTGGCACG
GATCTTCTCTCAGCTTCACCCGGCCTCTACAACGTTGATTGAGTCCATGATCGTCTGCAATGAAGTCGGAGTCGCTTCCTCAGGTTTAGGGATGGTGAGG
TCGCCTCTAGGGGAGGAGTGATGACGATGACGCATGCGTGCTGTCTCGACGAGATCCTTTTTAGAGTGGTGTGTGTGTGTGTGTGGTATCTTATGTGTGC
CGCTCATCGGTTGTGAAGGTTTCGCCCGGTTCTCCACAATTAACCGGGCAATCTGGTTTTCGCTCAGTTTTCCCTAATTAACTGAGCAACTC
page-top