Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig18
Contig Information
Length 333 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9m15    rwhms9m15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit conserved hypothetical protein [Ralstonia pickettii 12D] >gi|151577354|gb|EDN41755.1| conserved hypothetical protein [Ralstonia pickettii 12D]
Score 82
Evalue 0.926702
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig18
GGAAAGGATCCAGCCGTTGCCCTGCAAGGTCAAGTGTGCTGGTCGCTGCCCCGACGCCATTGATCGCCTTGCCTCCTGCTTGATCGCCTGCGACATGGAC
TCCATCTGTGACCAGCCAGGGCCGTCAGTCGATGTTGAGGTTTGCAGGAATGTCTGCCACGATATGTGGGTGGCGGGTGGCGCCAACTAACCTTGAAGGG
CTGCGAGCAGGTCGGTCATGGGATCATAAAAATATGATGTCGAACAGCTGTGGTTGCTGCATCAGTCAATAAAATGTGCTTCGCTTTGGTGCATCACTTG
TGTGAAAATTTGCCAATCTTAAGAAAAAAAAAA
page-top