Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig16
Contig Information
Length 649 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9i14    rwhms9i14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to GLIS family zinc finger 1, partial [Ornithorhynchus anatinus]
Score 92
Evalue 0.141057
Total Hit Count 74
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig16
ACCTTCTCCCCTTCATATCGCCGCCTTTCTTCGTCTGTGTTGCCTGATCCCGACGAGGGGTGAGGGGAGGGGAGATCAAGAGGAAATGGATCCCCTTCTC
TGCAAAGCTCTCAATTTACCGGCTCCGACATGCTGTTTGCCGAGGCCGGGCGGACCTGAGCGCGCTGCTTCTAGCGGCCGCCGTCAGATCGCTAGCCTCC
GACGCCCCCCTCCGTGCCTCCGGATACACAGTGGTGTCGCTGGCCTCTGACATGCTCCTCCTCCTACTGGCAGTGCTCCTCCGACGAGGCAAGACGCCAG
CGTCACTATAGAGCCAGGAGACGCAGGAGGAGCCCTACGCGTACAAGGACGAGGCCACCGACGGCACCAAGAAGAGGCTGACCTCAGAGGCGTCATGGGT
GGCGCAGTACGCCTCACCTCCCCTGCAAGCTCCCCTGCATGCTCGCCAAGCATGTCCTAAACTGCAGTGAAGATCCATCGGAAGAAGGGCAGCAGGGTGG
CATGCTCTGGAAGGTTGTACTGCATGCTCGCCAAACACATGATGTAGAAGGTTTAGTCTAGATAGACTGAATATGTTGTTGTTGTGGTCACCAGAGATCA
AATTTGTGCATGTATATANAGTATGATAATTTTAACTCTAAAAAAAAAA
page-top