Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig14
Contig Information
Length 647 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9j08    rwhms9j08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Podospora anserina] >gi|27764305|emb|CAD60585.1| unnamed protein product [Podospora anserina] >gi|170940040|emb|CAP65266.1| unnamed protein product [Podospora anserina]
Score 92
Evalue 0.139436
Total Hit Count 86
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig14
CTCGCACCGGCAAGCAGCTCCCCCGCGACCCCTGGAGCCGGACCCTCCCCTCCCCTGCCGCGCGACTCTGCTCTGCTCCTTCCGCCATCCCCGCGCGACT
CTCGCAGCCGGATCCACCCCTCCACTTCTGCAACTCCTCTCTGCTCCTCCCTCCCGCCATCCCCGCGCCACCACGACGGGCTACCAGCACGGGCAGCTGC
TGCCGTCCACAACGCCCTACCCAGCGAGCCCCGCCTGGCCACGGCTCCTCAAGCGGCTGTACTCGACGGTGCTCGCGCAGTACTCTGACTCCGGCCCGCG
GTGGAACTGCATTGCTTGGCCTCGTGCCGCATGCAGTTTGTTGCTCCTCTCCATGTGGTCCATGCACAGGTTGCACCACCATGGCTCGCTGGTAGTACTA
TCATCAGCAAGTCCGCTAGAAAAACAGGGTGTCCCATGCTGTAGTTTGGCTAGGGGCAGCACGGGGTTCAGTTTATTTTAGTTTTCAGATTTGCAGTGTA
GTCCAAGCTATTCATTATTTTGTCAGATCCACGACTCTGCGTGGGCTGCAATTGTTGAAAAACAGAAATACGTGGATGAAGTTCATTGTGTGTTTTCTCT
GAAGAGAAATCGAGTGAAAATTGCAGTCTGTTGTTGTAAAAAAAAAA
page-top