Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig13
Contig Information
Length 1338 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9j09    rwhms9j09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit conserved hypothetical protein [Lodderomyces elongisporus NRRL YB-4239] >gi|206558160|sp|A5DVI0|NM111_LODEL RecName: Full=Pro-apoptotic serine protease NMA111 >gi|146448932|gb|EDK43188.1| conserved hypothetical protein [Lodderomyces elongisporus NRRL YB-4239]
Score 85
Evalue 3.09143
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig13
CATTTCAGGTCCTCCGTTCTCCCCTCGCATCGCCCCTCCCTTCCCCCTCCTCCCTCTGGAGGCACCGAGCATGAAGACGCCGAGCGGCGATTCCGTGAGA
GCAAAGCGGCACTTGGATGCTTCGGAGCTGTCCCCAAAAAAACATAAGCCGGGGGGTTCATCTTCTTCCTCGGGCTCTCATATGGATGCAGAAGCTCCGA
TTCCTACCGTTCCTGCAGATCAAATTAATCCTCCAGCAGCTGATGTTCCTCAGCCTACTTCTGTTGCTCGTGTCCCCCTTTCAGGTGGCAATAGGGCCCA
TGAGTTATTTATAAAAGTGTCGCCCTCTGTTGTCACAGTAACACTTAAGTGTCCCTCTGGCTTACAGGAAGACAAGCGTGGAACTGGCTTTATCATCTCA
GCCACGGAAAACTATGCTTTAGTTTACACTTCGTTTTCTTCTGCACAACATGGAGTGAATGTGTACCATTATTCTGTCTAGCTTGAAGGAAGTAGTCAGG
GAGTTACAGCTTATATTCTGAGTCGTGATCCCAATGAGAAGTTCATTATCTTGATTGTCCAAACCCGTAAAATGCATGCAACTGTCACATTATCGGATAT
TCCTCTACAGTACGAGCCTGTTATAACTGTTGGTGCTATGGCTATTATACGAACTACATACGTATGTTCGGATACCCCAATAGATGAATCATCTCTTGGT
AGTTTGGAAATGCATCAAGGTGGAGTGCTAACTCCAAACTGTTCTGCCCTGACTCTTGATTATAAACCTTTGAAAGGGTCTGATAAATATTTTGAAGTGA
AGTGTCTTGCCCAGGATTCTATTATTGAAATGGAGTATATTGATCTCAAGAAGCATACTGCATACAGAATAGAGTCTGCCCCTGTGTTTGATATGACTGG
TAAAGTGGTGGGTTTAATATACTCAGCTGGTACTGATGTTGATGTGAAGAATGGGTTTCTGTCCAAATACATTATCTCATCCTTAAGATCCATCTGTAAG
AATACTGACTGGGAGGCAGGACTTAAGAGAATGGGGGACCTGAAGTATTCTAACATGTTTGGCAATGAAGAATGATTGTACTTACAAATGGCTTCACTTT
TTGACATGGCAATGCCACCACTGGCATCTCTTCTCTGAGATGGTGATGATATGAGAACAGCCTTCTGCATCAGGGATTTTATTTTTTTGCAAAACCGCTT
TTGCTATATTCTTAGCCTTTTCTTAGGTAGCACCAAGTAGTTTCTTGGTTCTTTTGACCTTATGGAATGTTTAACTAATACGAGACTCCTGTTCTCTTGG
ATTGATTGGTGTATGAGGAGAACTTCGCCGCCTGCCAA
page-top