Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig12
Contig Information
Length 1244 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9l13    rwhms9l13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0635400 [Oryza sativa (japonica cultivar-group)] >gi|20161826|dbj|BAB90741.1| mRNA-associated protein mrnp41-like [Oryza sativa Japonica Group] >gi|55296031|dbj|BAD69442.1| mRNA-associated protein mrnp41-like [Oryza sativa Japonica Group] >gi|113533194|dbj|BAF05577.1| Os01g0635400 [Oryza sativa (japonica cultivar-group)]
Score 1630
Evalue 1.95408e-179
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig12
CTTCCTCCCCTCCCTCCCCCAAATTCGCCCAACACCTTCGGAACCCCAATGGCGAGCTTTAACGCCGCCGGCGCCGGCGCCGCCAACCCCAACCCTAACA
AATCCCTCGAGGTGAATCCGGCGCCCGGGGACTCGGTTTCCAGCCTCAGCTTCAGCCCCAAGGCGAATCACCTGATTGCCACCTCCTGGGACAACCAGGT
TCGGTGCTGGGAGGTTCAGCCTGGCGGCCAATGCCAGGCGAAGGCGTCTATTTCGCACGATCAGCCAGTCTTGTGCTCTGCCTGGAAGGATGACGGGACT
ACTGTTTTTTTGGGAGGGTGTGACAAAGTGGTAAAGATGTGGCCGCTGCTGTCTGGCGGGCAGGCCACGGCCTTCTCAGGGCACGAGGCGCCGGTCAAAG
AACTTGCCTGGATACCACAGATGAGCCTTCTTGTCAGTGGGTCTTGGGATAAGACTTTGAGGTACTGGGACATTCGACAACCTAACCCAGCTCATGTTCA
GCAACTTCCGGAGCGCTGCTATGCACTCTCACTTAGTTATCCTCTAATGGCGGTCGGTACTGCTGATCGCAACGTAGTTATCTTCAATCTTCAGAATCCA
CAGGCTGAATTCAAGAGGATTGTGTCACCTTTGAAATTCCAGACAAGGTGTATCGCTGCCTTCCCAGATCAACAAGGATTCTTGGTCGGATCAATAGAGG
GACGCGTTGGTGTTCATCATGTGGATGATTCTAATCAAAGCAAGAATTTCACATTCAAATGTCATCGCGAGGGCACTGATATATTCTCTGTTAACTCGCT
GAACTTTCATCCTGTGCACCATACATTTGCTACTGCAGGCTCTGATGGAGGTTTCAACTTTTGGGACAAGGACAGTAAACAAAGATTGAAGGCTTTTAGT
AAGTGCCCATCACCCATCACATGCAGCACATTCAATCAGGATGGCTCAATCTTTGCTTATGCGGTATGCTATGATTGGAGCAAGGGTGCCGAGAAGCATA
ATCCTTCTACTGCAAAGACAAATATCTTTCTGCATAGCGTGCAGGAATCTGATGTCAAAGGAAAGCCCCGTACTGGAAAAAAGTAGAGACCTGGAAATGA
CAAGCTGCAGATCTGTGCTCGGATCCTGATGAGTTCGCCATCGCCTGATGCTAATTACCTGCACGAGTGTTTTAGATCTTGACTCTCTAGGGCATTTCTT
CATCTCTGAGACTGCAAGCATATCTTCTATAAAAAGCAGTGCAT
page-top