Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig11
Contig Information
Length 579 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9l09    rwhms9l09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit DRP1 protein [Triticum turgidum subsp. durum]
Score 520
Evalue 2.48522e-51
Total Hit Count 25
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig11
CTCGCCGCCGGTGAAGTCGCCATGGCCGACCACGCCGCAAGCGAGGAGGAGCCGCCCATCCTGCTCGACCGCGCGGCGCGTGCCACCCGAGGAAAGAGGA
TAACCAAGCTCGTAGAGGAGGAGGTCGAGCTTGACGAGGCTTTCTGGGGCCAAGAAGCCCTGAAGGAGGACGAGGAGGATGATAACTATCAGGAAGAGCA
GGATGCTGGTGATGTATTCGACAGTGATTTCGATGAAGATGAACCTCAACCTGACGACGACCCAGAGAAGGAAGTGAGTGAGAGATTACCTATTAAGAAG
CGGCTAGTTTTCCCTGGGAAGACCATGAAAAAAATGAAAGCCAAGAAGAAGAAGAAGAAGAATAAGGTCATCAAACTAGAGGATGATGAAGGCATAGATG
ACAAGAATCCTGATAAGACAACTTCATCCAAACAATCAGATGTTCCTGATGAATGGGAGTCTGAGAAAACGATCAGGAAATCAACCAGAACATCTGTCAT
TGTGAGACAAGCTGAGCGAGAAGCAATACGTGCTGAAAAGAAAGCTACTGCTAAGCCAATTAAGAAGAGAAAAAAAAAA
page-top