Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig10
Contig Information
Length 888 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms9l07    rwhms9l07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit MBD1 [Triticum aestivum]
Score 718
Evalue 4.67195e-77
Total Hit Count 46
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig10
ATCGGCACGAGGCCGACCTTGGCTCCGTCCTCTCGCATCCGCCCGCCTACTACCGGCGCCGTCGCCGGTGGCTTCTCCAGCGGGGCGCCTCCGAGTTCCC
GACGCAGGCCACCTCACTGTCGAACATGGCCTCGCCGGCGCCGGTTCCGGCCTCGCCGGGGTCCTCCTCTCAGAAAAAACGAGGTGCAACGGAATCAATT
GGCCTGTATGCTGTCCCAGTGTTGTGAATGTCATAAATGGCGTACAGTTTCAACGAAAGATGAATTTGAGACAATTCGTGAGAACTTCACTGAAGACCCA
TGGTTCTGCAGTAAAAGACCTGAGTGCTCGTGTGAAGACCCTCCAGACATTGAGTACGACAGCAGCCGCATCTGGGTCATCGACAAGCCCAACATACCAA
AGCCTCCGCCCAAGACCGAGAGACTTGTGATCATGAGAGGTGATCTGTCTAAAATGGACATCTACTATGTCCTGCCAAACGGGAAGCGTGCAAGGGGCAT
CGGGGACGTGCAGAAGTTCCTCGACACAAACCCAGAGTACAAAGACCGCATATCAGCTGAAAGCTTCAGTTTTACGGTGCCCAAGATCGTTGAGGAGACC
GTTTCGCAGAGCTCTTTGTGGAAGACTAAAAAGGCTAAAAAGCAGGACAAGATAAATGCTTCAAGCAGCAAGAAGGACAAGGCAAATGCTTCAAGCAGCG
AGAACTAGCCATGGCAGCAAATGCAAAACTGTCGCCTGCTGCTTGGATGATCCTACCTCATCTACCTTGAAGTTAGTCATCAAGTCGGGTCTCTCTCTCT
GCGATGTTACTCTGAGCGCTCCAATGCACTGAATCTCTTCGTTTTTATGCACGAGTTTCTGGTAAAATTCTGAGATGCTCGAGAAGGG
page-top