Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig7
Contig Information
Length 396 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhms1d04   
Homology (BLAST) Top Hit Os02g0793500 [Oryza sativa (japonica cultivar-group)] >gi|47497144|dbj|BAD19193.1| hypothetical protein [Oryza sativa Japonica Group] >gi|47497591|dbj|BAD19661.1| hypothetical protein [Oryza sativa Japonica Group] >gi|113537901|dbj|BAF10284.1| Os02g0793500 [Oryza sativa (japonica cultivar-group)] >gi|125583983|gb|EAZ24914.1| hypothetical protein OsJ_008397 [Oryza sativa (japonica cultivar-group)]
Score 300
Evalue 4.81471e-26
Total Hit Count 76
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig7
ACCGCTGCCNCCATGATGTTTCTGGCATACCTCACAAATTTGTCTTCTGCCCGAAACCCATAGATACAGAGCTCAGCCAGGCTGTGGTGATTGAAATCTA
GGGCAGATGGTTCCCACTCCAGTCCTTTGTCCTTCTCCTCGCTAAACTCATGCAAGTACCTCCGCTTCCCCTTTGTCATTTCACATAAATGATCCCGCAC
CGTAATGCATAGTTCCTTAAGGGTGGGTGCGCCTTGGAGTATGAACATCGTCCAATTCAGATTGCATTCTTCGGAAATGTTGAACAAATTCACAAAACTT
AGTTTGCGGAACACCGGTAACAAATGCTTTCGGCCTTCTGGTTTGACCCAAATCTTTTCACATCTGAAGTTCAATGCAGGGTTGCTTATGGCTGTT
page-top