Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig6
Contig Information
Length 717 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhms14p24   
Homology (BLAST) Top Hit hypothetical protein OsI_01061 [Oryza sativa Indica Group]
Score 558
Evalue 1.59756e-55
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig6
CGGCAGCTATAATGCTTTCCATATCTGGTGCCACAACTTTGGGAGATTATAAAAGGAACCTAGAGAAGTTCCACCACTGGAATTTTAGTCTTTGTTCAGC
ATAATTATCCATTCACGCATGCAACTCTGCAGACAGAGTGATGAAAAATTCAAACACACATAAGGTTACTAGCTTCATTGCCCAGCACGCAAACAGCATC
ACCTGGGCGTATGATCTCCCCAGAAGGATCAAAATATTAGAAGGGGATGCATCACCTTCAGAGATTTGAAATCTCATGGGGCAGGTGGTTCACTTAGAAC
AAATGCTTGAACAAGACTTCGGGCTGCATGCATCTGATCCGGTGTGCCAGATATCATAACAGGTGTATCCATGGAATCAGCCAGCGGTTCCTCGATTGTT
ATCTTAGCTCCTGAAAACTCACGTATCATATTCAAACAACCTCCATCATGCCCACATAGAGCAGGTATAACTAATCTTGGAACCATGATATTTCCAGTTA
TGATTGGCCTAGATGAATGAACAGGTCCTGAAAATCCACCCATTCCTCTGTGTGCCATTCCAGGAATGCCAGATACTGACATCGGATCACCAACATCCTT
TGTGGTCCAAGGAGCAGACATCTCATCCAATGGTCGTCCCATGAAATCTTTATGAAACTGAGATGCATTAGGATAAATCCTAGGAGATGTAGATTCATGG
ATTCCCGCAAATGCACC
page-top