Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig5
Contig Information
Length 820 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whms2g11   
Homology (BLAST) Top Hit polyubiquitin [Pinus sylvestris]
Score 1099
Evalue 3.65707e-122
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig5
CAAATCCCCAAGCCAATCTCGTCTCCGATCGACTCCAGCTCCCCTTCCTCCGGTCCTCCCCGCCGCCCCAAGATGCAGATCTTTGTCAAGACCCTCACTG
GCAAGACCATCACCCTTGAGGTCGAGTCGTCTGATACCATCGACAATGTCAAGGCTAAGATCCAGGACAAGGAGGGCATCCCCCCGGACCAGCAGCGCCT
CATCTTTGCTGGCAAGCAGCTGGAGGACGGCAGGACCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCTCCACCTTGTCCTCCGTCTTCGTGGAGGC
ATGCAGATCTTTGTGAAGACCCTCACTGGCAAGACCATTACGCTTGAGGTGGAGTCATCCGACACCATCGACAATGTGAAGGCAAAGATCCAGGACAAGG
AGGGCATCCCCCCGGACCAGCAGCGCCTCATCTTTGCTGGCAAGCAGCTGGAGGACGGCAGGACCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCT
CCACCTTGTCCTCCGTCTTCGTGGAGGCATGCAGATCTTTGTCAAGACCCTCACTGGCAAGACCATTACGCTTGAGGTGGAGTCATCCGACACCATCGAC
AATGTGAAGGCAAAGATCCAGGACAAGGAGGGCATTCCCCCGGAACAGCAGCGTCTCATCTTCGCTGGCAAGCAGCTGGAGGACGGCAGGACCCTTGCTG
ACTACAACATCCAGAAGGAGTCCACCCTCCACCTTTGTGCTGCGTCTTCGANGAGGCATGCANATCTTTGTGAAAACCCTCACTGGCAAAACATTACCTT
GAGGGGGAGTCCTCGGANAC
page-top