Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig4
Contig Information
Length 694 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whms10a24   
Homology (BLAST) Top Hit putative ribosomal protein S18 [Triticum aestivum]
Score 266
Evalue 1.06996e-21
Total Hit Count 319
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig4
ATTAAGCCATGCATGTGCAAGTATGAACCAATTTGAACTGTGAAACTGCGAATGGCTCATTAAATCAGTTATAGTTTGTTTGATGGTACGTGCTACTCGG
ATAACCGTAGTAATTCTAGAGCTAATACGTGCAACAAACCCCGACTTCTGGGAGGGGCGCATTTATTAGATAAAAGGCTGACGCGGGCTCTGCTCGCTGA
TCCGATGATTCATGATAACTCGACGGATCGCACGGCCTTCGTGCCGGCGACGCATCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGGGGC
CTACCATGGTGGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAA
TTACCCAATCCTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCGCATTAGTGTCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGA
GGATCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCATGTCGCTGATCGCGGGTGAGGAGTTCCAGCACATCCTTCGTGTGCTCAACACCAACGTCGACGG
TAAGCAGAAGATCATGTTCGCGCTGACCTCCATCAAGGGTGTGGGCCGCCGCTTCTCCAACATCGTCTGCAAGAAGGCCGACATCGACATGAAC
page-top