Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2
Contig Information
Length 684 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhms5o01   
Homology (BLAST) Top Hit hypothetical protein OsI_01061 [Oryza sativa Indica Group]
Score 583
Evalue 1.83812e-58
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2
CATCGGTATGATAGGGTTCTCACACAAAAAGGTTAGAAACTTTCCAACCCCAAGCTACGGCTTGCATAAAGTGATAGATTCAGGCAGCTATAATGCTTTC
CATATCTGGTGCCACAACTTTGGGAGATTATAAAAGGAACCTAGAGAAGTTCCACCACTGGAATTTTAGTCTTTGTTCAGCATAATTATCCATTCACGCA
TGCAACTCTTCAGAGATTTGAAATCTCATGGGGCAGGTGGTTCACTTAGAACAAATGCTTGAACAAGACTTCGGGCTGCATGCATCTGATCCGGTGTGCC
AGATATCATAACAGGTGTATCCATGGAATCAGCCAGCGGTTCCTCGATTGTTATCTTAGCTCCTGAAAACTCACGTATCATATTCAAACAACCTCCATCA
TGCCCACATAGAGCAGGTATAACTAATCTTGGAACCATGATATTTCCAGTTATGATTGGCCTAGATGAATGAACAGGTCCTGAAAATCCACCCATTCCTC
TGTGTGCCATTCCAGGAATGCCAGATACTGACATCGGATCACCAACATCCTTTGTGGTCCAAGGAGCAGACATCTCATCCAATGGTCGTCCCATGAAATC
TTTATGAAACTGAGATGCATTAGGATAAATCCTAGGAGATGTAGATTCATGGATTCCCGCAAATGCACCAAACTGAGGATCCAG
page-top