Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig2486
Contig Information
Length 1332 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 11 Clones [Download: CSV  ,  FASTA ]
whkv2k02    whkv3g07    whkv5o04    whkv7o10    whkv13i24    rwhkv2k02    rwhkv3g07    rwhkv5o04    rwhkv7a12    rwhkv7o10    rwhkv13i24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PWS4.3, chloroplastic; Short=RuBisCO small subunit PWS4.3; Flags: Precursor >gi|170769|gb|AAA34301.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 800
Evalue 3.78733e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig2486
TAGACAGATCTCGTCCATTGATGTATTCGGGGGTTGTGCCGAAGAAGAAGATATAGACCTATGAGGAATTACGTATGCATGCTCAAGAACCTATGTTCGT
ACATACATACACAAAATCATATAGAACAAAAGGTATGCTCCGGTCAGAAAGCAGAGTCGTACAGCAGAGTTTTGGACAAAAGTGAAGTTCACAAAAGACC
TTCATACGAGATAGGCCATTGTTTCAACTCGTAGTTTAGGCCTTGCCGGACTCCTCGCAACCCGGTGGCCTAAAGGCGATGAAGCTGACGCACTGCACCT
GGCGCAGGTTGTCGAAGCCGATGACACGGACATAGGCGTCAGGGTACTCCTTCTTGACCTCCTCCACCTCGTTCAGCACCTGTGTGGCGTCAGTGCACCC
GAACATAGGCAGCTTCCACATTGTCCAGTATCGGCCGTCGTAGTACCCGGGGGAGCTGTTGTGCTCACGGAAGACGAAGCCAACCTTGCTGAACTCGAGG
CAGGGCACCCACTTTGAGCGGATCAGGTAGTCGACCTGTTTCAGGAGGGCCTCCGTGGATAGGGGTGGCAGGTAAGACAGGGTCTCGAACTTCTTGATGC
CCTCAATTGGCCACACCTGCATGCACCTGATCCTTCCGCCATTGCTGACGCTGCTGAGGCTGCCGCTGGAGCGGCGGCCGACGGGGAGACCGGCTGTGGA
CTTGAGCCCCTGGAAGGGTGCGACGGTGGTAGCCGAGGAAGCCATCACGGCGGGGGCCATGGTAATGTATTATCTGGAGGAGAGGAGGATGCCCTCGTGC
CGAATTCGGCACGAGGGAGAGACGTGTCACAAAAATACAAATAGGTTGGCATAACGCATAACAGGCAGCTGTAGGGACATACTTTCAAGTTTCAAAGATC
CTAAAATCAGAACCAAAATTACTAACAGATATCCATCGCTCGATAGCCAAAATACAGAGATTGTTAAGTCTTCACTCCACTACAGAACCCCTGGATTCCT
CAAGACAACAGTAGGGCAATCATGCTTCGGTCTGCTCCCTCAAGCGACGGATCGTGCTCCTGACGGTGACTGCACTAGCAGTGTTCATGGTATAGGCGCC
GCCAGCCTTGACCTTGCCACAGTCCTTGCATCCCCAAATTCCAACAGCTTTCCTCTTCACAGCAAACTTCCCACAGAATTCACAGAAGTACTTGGAGTGC
TGAGACACCTCCATCTTCTTGATCTGCTTACGCAAACTGGCACCATACCTGGTACCATACTTCCCGACGATTCCGGCCTTCTTGGTGCGCTTCGTCATCT
CGGCGGCGGGTAGCAGGAGGCGGCTGCGGCGG
page-top