Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig2484
Contig Information
Length 770 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 11 Clones [Download: CSV  ,  FASTA ]
whkv13n17    whkv14p02    whkv20n10    whkv20n21    rwhkv8o15    rwhkv13n17    rwhkv14p02    rwhkv14p13    rwhkv14p14    rwhkv20n10    rwhkv20n21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit translation initiation factor [Triticum aestivum]
Score 513
Evalue 3.01621e-50
Total Hit Count 304
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig2484
TTTTTTTTTTACCACGCTTAACAAAGCATATATTATTCAACCTTGATGGGAGAGGGTAACAAGCCATCTAAAGATGGTGCTCCTTACAAAGTTTCAACAC
AACGGTAACAAGCATACACGCAGAGAGGTGGGCTATGCTAGATTTTCTGTATACTCAGAGCGCGCAAGCTGGTAACGCCTGCTAGCGCTAGCACACAACT
AAATATACTGCACCACCAATATATAGCTGCTTTGCATGTAGACTCTGATATGGAGCTGGCAGTTGCTCAGAAACCATGAATCTTGATGTGTTCCTTCTTC
ACAATGCCGGCCTGGACAAGGAAGTTTGAGACGTTCTTCCTCTGATCACCCTGGAGTTGAATGACCTGTCCAAGTTCTGTGTCCTGGACAACTGTACCAT
TGCAGCAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGCTGTAGCTGAACTCCTTCTTCAGACCCTGGACAGTGGTCAGGCTCTTGCGACCATTACGCTG
CTGGATGCGTACATGAACGTAGTCTTTTGATCCGGCAGCTGCACCAGCGTCCCCAGCATTCGCCTCGGCAAAGGGGTCAAAGGCAGTTGGGATCTGAACG
TCAAGATCAGACATGAAATCTCCTGCTGAGACTGGCAAAAGCTGCACCAAGAACCTGGGAGGCGGTCGAGGAGGAAGAGATCAACCAAGATCTTTCCCGG
GAGGATTTGGATCGCGGAGAGGCGCTGGTAGTGAGTCCTTGGTGTTCTTCCTCCTCTTTGCGGCACGAGG
page-top