Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig2413
Contig Information
Length 1501 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 8 Clones [Download: CSV  ,  FASTA ]
whkv1a13    whkv15i14    whkv15l03    whkv19n17    rwhkv1n04    rwhkv15i14    rwhkv15l03    rwhkv19n17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08713 [Oryza sativa Indica Group]
Score 1770
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig2413
ATCTCAGTAGGATTGGAGGACAATGTATTTAAGGAAAATTGCCCAGTAACGATTCAGGGCACATACTCGAACTCAAACTCAACCCCTATGATAGTAAATG
TTTTGAGAACGCTGCCGCCAACCTACGACAACCTCTGGAGTTCGATGCCTCCACCAAAAACGAATGTTGGGAAAATCCACCCTCTACAGAAATTATTGCC
TTCCAACGTTAAAAAGATAAAAGTTCGCCAGATCCTTGAAGGGCAGGACTGGGAACAGACTTCTCTTGTTCGTCATCATTTCTTCCCCTCTAGGCACCGC
CTGAGCCGTACTTCTTGCCGAAGAAGAGGATCTGGAGCTGATCGTAGCCGGAGAGCACACCAGCACCAGCAATGGCACGGAGGATGTTGGCACCAGCACC
CTTGAAGAGAGACTTGGCACCCTCCTTCGCCAGGATCTGCTGGAAAGCATCCAAGGAGCTCTTGTACTTGACAGCCTCTCCGGAGGTCATCATCATCCTT
CTGCGGACGGTGTCAATGGGGTAAGATGCAAGACCGGCACCGTTGGTGATCAACCAACCAAGAGCAAAGCTGGCAAAGAAGTTGTCCTGGAGAGTGCCAG
TGAGGAGAACGGGCTTCAGAGAATCATACAGTCCAAAGTACAGACCACGGTAGACAATGATTCCAACACAAGAGATGTTGAATCCACGGTAAAGCCCAGC
AATACCATCTGACTTGAGAGTCTTGCGGTAGACATCAACCAGGCCATTGAATTGCCTGTCACCTCCACCCTTGGATGCCTTTGCGTCATTGGCCAGCCTT
GTCCTAGCATAGTCCAGGGAGTACACGAAGAAGAGCGAGGAAGCACCAGCAGCACCACCAGAAGCAAGGTTGCCACCGAACCACTTCCAGTAACCATCCT
TGTCCTTCTTGAAGTTGAACATCCTCTTGAAGTAATCCTTGAATGCAAAGTTCAAAGCCTGAGTTGGGAAGTAACGGATGACGTTAGCAGTGTTTCCTCT
CCACAATGAGCCAAAGCCTTCATCCTTGATGGTGCGGCCAAAGCAGTCACCAATACCCTTGTATGGCTCAGAGAGCCTGCCAGCCTTGATCATCTCATCC
TGGTTCTGGATAAGCAGCTTAACACGCTCAATAGGAGCTGCAGCAGTCTTGGAAACTGCAGCGGACACTCCTCCCATGAGGAAGTCAATTGCAAAGTTCT
TGACACCTTTCTTCTCAGGTGGTGCATTGGCAAACAATGGAGAAGATGACATCATGGGGACACTGATGCCAAGGTTCTGAGTCATGTAGCAGCTTGTGGT
GAAGCGCCTCTCATAGGATGGCACAGAAGGGCAGATGTTGCGAGCACGAACACCCTCAGAGAAGCTGGAGGCAAGGTGGAACTGTCCACCAAACTTCTGC
ATGACAGACGGGTGGTTAGCACGGTCCGCCATCTCTGACCCTTCGGAAGCGGAGGCGAGGAAGATGGGGTGGTGGCTCTTCCCGGCTCGGCGGCTCCGCT
C
page-top