Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig2403
Contig Information
Length 1486 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 7 Clones [Download: CSV  ,  FASTA ]
whkv17i11    whkv17i12    whkv18c22    rwhkv10c12    rwhkv17i11    rwhkv17i12    rwhkv18c22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit methionine synthase 1 enzyme [Hordeum vulgare subsp. vulgare]
Score 2062
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig2403
ATGATGAACAATTCGCCACTCAGTTTACAATACACACCGACAACCGCCTCAAAAACCACCAAATCAAAGGGATGAGCACATGGCGCCGCGCCGCGCCGAG
AAACAAACTAGCCTAACCAACAGGTGGATACAGAGACCCAGATTATTCAAAGTAAACACGGCTATGGTGGCGACATCCTCCTTGCAATTAAAATGGGGGA
GCTGCTATACGGCTTACTGCGCCTTGGCGAGCTCGGCGCGGATCTGCTTGGCGGCCTCGACCATGTTGGTGAGGGCGGGCTTGACCTCGGCGTACTTGCG
GGTCTTGAGACCGCAGTCGGGGTTCACCCACAGGATGTTGGTATCGAGCACCGCGAGCATCTTGTTGACACGGTCGGCGATCTCCTCCTTGGACGGGATC
CTGGGGGAGTGGATGTCGTACACGCCCGGGCCAATGCCGGCGCCGTACACCACGCCCTCGCGGAAGACGGAGAGAAGCTTCTCGTCGGACCGCGAGTTCT
CGATGGTGATCACATCGGCGTCCATGTTGATGATGGACTGGATGATGTCGTTGAAGTTGGAGTAGCACATGTGGGTGTGGATCTGGGTGGTGTCCTGGAC
ACCGCAGTTGGTGATCCTGAAGGAGTGCACGGCCCAGTCCAAGTAGAAAGCGTGCTCCGACTTGCGGAGTGGCAGACCCTCTCTCAAAGCAGCCTCATCG
ATTTGGATAACCTGAATACCACCAGCCTCAAGGTCCTCGACCTCCTTCTTGATTGCAAGAGCAATCTGGTAGCAAGTCTCAAACCTCGGTTGGTCATTTC
TGACAAAAGACCAGTTAAGGATTGTGACAGGGCCTGTCAGCATACCCTTCATTGGGCGAGCAGTCATGCTCTGCGCCATCTTGGACCAGAAGACGGTCAT
GGGGTTGGGGCGGCTCACATCACCATAGATGATCGGTGGCTTGACGCACCTTGATCCGTAAGATTGCACCCAACCATTGGCAGTGAACGTGAAACCAGAG
AGCTGCTCACCGAAGTACTCAACCATATCGTTCCTCTCAGGCTCTCCGTGCACAAGCACATCAATGTCAAGCTCTTCTTGGATCTTAACAACCTTGCTAA
TCTCCTCCTTGATGGCATTGGTGTACTCCTCCTCAGAGATCTTCTTTGCCTTGTACTCACGGCGGACTCTCCTGAGCTCCACTGTCTGTGGGAATGAACC
AATGGTGGTCGTGGGAAGGATCGGAAGGTTGAGCTTCTTTTGCTGCGCATCCAACCTAGCGCTAACGGTGGTAGCGCGGCGGTGATCAGAGCCCTTGAGG
GCGGTGGCAGCCTTCTGGACCTCCTCATTTGTGACACGTGGTGACGACCTTCTTGAGGCCAGAGCAGCAGCATTTGCAGAGAAGTAAGCCTCATCCTTTT
GACCAGCCAATGCCTTGGCAAGGGCGTTCACCTCAACGACCTTTTGGGCAGCAAATGCGAGCCATGACTTAATCTCATCATCAAGC
page-top