Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig2316
Contig Information
Length 1097 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whkv1g17    whkv11k05    whkv13g14    rwhkv11k05    rwhkv13g14    rwhkv13h01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38068 [Oryza sativa Indica Group]
Score 1094
Evalue 2.32708e-117
Total Hit Count 497
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig2316
CCCCGACGCTCAAGCCCCCAGACGCCGCAGCGCCGCCACTCCACCCGCAGCGGCAACCATGGCGGTCGGCAAGAACAAGCGCATCTCCAAGGGGAGGAAG
GGTAGCAAAAAGAAGGCCGTCGATCCGTTCACCAAGAAGCAGTGGTATGACATCAAGGCGCCGCTGCTGTTCACCAGCCGCAACGTCGGCAAGACCCTCG
TGTCCAGGACACAGGGTACCAAGATTGCCTCAGAGGGTCTGAAGCACAGGGTGTTCGAAGTATCTCTAGCTGATCTTCAGAACGATGAGGACCAGGCCTA
CAGGAAGATCAGACTCCGTGCTGAGGATGTGCAAGGGATGAATGTCCTCACAAACTTCTGGGGCATGGACTTCACCACTGACAAGCTCAGGTCTCTTGTG
AGGAAGTGGCAGACACTCATTGAGGCTCATGTGGATGTGAAGACCACTGACAACTACATGCTCCGCATGTTCACCATTGGCTTCACGAAGAGACGCCCAA
ACCAGGTGAAGCGCACTTGCTATGCCCAAGCAAGTCAGATCAGACAGATCCGCCGCAAGATGGTTGAGATCATGGTCAACCAAGCTGCAAGCTGTGACTT
GAAGGAGCTTGTGAACAAGTTCATCCCTGAGGTGATTGGAAAGGAGATTGAGAAGGCCACCTCAAGCATCTTCCCCCTCCAGAACGTGTACGTCCGCAAG
GTGAAGATCCTGAAGGCCCCCAAGTTTGACCTGGGGAAGCTCATGGAGGTGCACGGTGACTACAAGGAGGATGTTGGTGTGAAGCTTGACAGGCCTGCTG
ATGGAGATGAGGTGATTCCTGGAGCGGAGGAGGTTGCTGCTGCTGAGTAGAAAATAGAAGTCGCTATTTTGCTGCTTCATATCTAGAAGATGATATATGT
GCCACCTGGGTGTCGTGAACTTTGTAGTCAGTTTTGATGGCTGATTTCTTGAGTACTTCTGTCGACATTCCTAGCCAGCGTTCAGTTATCTTATTTTGTT
CGTGTTACTTTCTGGATGGAGGTTATGAGTTTAAAACTAAATATTTAGTTTATTCCTGCCGTGTGTGTTTTATGTTTGAATGGAACTTATGCTCTGT
page-top