Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig2280
Contig Information
Length 1109 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whkv5h24    whkv8i08    whkv8k12    rwhkv5h24    rwhkv8i08    rwhkv8k12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0615200 [Oryza sativa (japonica cultivar-group)] >gi|23237931|dbj|BAC16504.1| unknown protein [Oryza sativa Japonica Group] >gi|113611804|dbj|BAF22182.1| Os07g0615200 [Oryza sativa (japonica cultivar-group)] >gi|215696974|dbj|BAG90968.1| unnamed protein product [Oryza sativa Japonica Group]
Score 517
Evalue 1.34123e-71
Total Hit Count 220
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig2280
GCACGAGGAAGGCGAGCCAACCACCACCGCCGCGAGACTAGCACCACGAGCGAGCTCGGCCGATTCCGATTCCGTCTGCGCTATTAAGGTTTGTTTGGAG
GAAGGGGAGGAGGTTCGGAGGTGGAGCTGAGAGAGAGACCGGAGATGGCGGCTTCCGCGAGGCAGGGGGAGAGGGCGACCAGCTTCGCCATGGCCTGCAG
CCTGCTCAGCCGCTACGTCCGCCAGAACGGCGCCGCCGCGGCCGAGCTCGGCCTCGGAATCAACAAGGGTGAGGCCGAGGCTCACAGGACGGCGGACACC
AAGAGCCCTTTGCCTGGGGCGGAGGGCGAGGAGGCCGGCAGGAAGAAGGAGACCATGGAGCTCTTCCCGCAGAGCGCCGGCCCTGCAGGACGCCGCCGCC
CCTGACGCTACTAGGGAGGAAGACAAGAGCCAGCTGACCATCTTCTATGGTGGGAAGGTGCTCGTGTTCAACGATTTCCCAGCCGACAAGGCCAAGGGCC
TGATGCAGTTGGCTGGCAAGGGCAGCCCGGTTGCTCAGAACGTCTCTGCGACCACAACTGCTGCAGACACCGCCAAGGTCCAGACGGCCGTGCTGGCCCC
GGCAAGTAGTTTGCCTAGTGATCCGGTTGTTGCTCCTAAGTCTGCTCGTCCGAATGCTTCTGATCTGCCAATTGCTAGAAAGGCGTCACTTCACCGATTC
CTTGAGAAGAGAAAGGATCGTCTGCATGCAAAGGCACCATATCAAGCTTCTCCTTCTGATGCAACACCAGTCAAGAAGGAGTTTGAGAACCAGCCATGGC
TTGGACTGGGGCCGAATGCCGCCCTGAAGCCAAACCAATAAGGCGGCATGACAGGAGCCTTATGCCCTTACCAGAAACATCTGAAATGTGCTTTGTCCTA
GCGTTTTGTTTAGGTTATGGTTCTGTGTTATTCGCCTCCATAGTTCCGATGTAAAGAGAAGTAGCAAATGATGATGACCGGTGCCCGAAGCCCGAGAGAA
GTTTTGGCATGTTAACACATGGTGATATTGAGTTGGCCATGCTAAGGAAAAAAAGTTAGTGCAAAGAAACATATTTGTATCCTATATGTAAACTCTGATC
ATTCCGTAT
page-top