Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig2219
Contig Information
Length 519 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 5 Clones [Download: CSV  ,  FASTA ]
whkv3o11    whkv6m09    rwhkv1n05    rwhkv3o11    rwhkv6m09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L30 [Triticum aestivum]
Score 514
Evalue 9.04218e-51
Total Hit Count 357
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig2219
AGCTCCAACTCAGCGTCGCAAAAAGGTACATAAACCGAAGATTACAAGAGTGGTTTCGAGAGCACAACAGGACCCTACAACTCGACTAAATAAAATAGGT
GGAGAGCTCTCTTCTCTTCTCTTCACTGGGTGGTGGTGGTGGTGCTGATGATGTCCGAGTCACCAGGGTCAAGGATGCTGAGGCAGCACACCCGGTAGTA
CTTGCCGCAGGCTGTTCCAAGATCAACATTGTTTCCATGGAAATGGTGCACGCTAATTTTCGCCAACATAGCGTAGTACTCAATCTCTGACTTCCTCAGG
GGCGGGCAGTTGTTTGCGAGGATTATCAGCTTCCCCTTGGAGCTGCGCAGCGTCTTGAGGACGGTCTTGTAGCCGAGCGTATACTTGCCGCTCTTCATCA
CCAGCTGCAGCTTGTTGTTGATGTTCTCCCCGCTCTTCTTCGCCTTCTTGGTGGGAGCCATCGCGTCGGGCGGCCGCGGCGAGCGAGCGTGGGGATGCGG
ATGGCTTCGGGGGAGGCGG
page-top