Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig2065
Contig Information
Length 2172 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whkv8n18    whkv13n11    whkv17g24    rwhkv17g24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1828
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig2065
TCACCCGCCGCCGCTTCTCCTCCTCCGGAAGAAAAACAGAGAGCTTCAAGTTCTCCGGAGCGAGAGAGATGGCGGCGAAGGGCGATGGGCCGGCGATCGG
CATCGACCTCGGCACGACGTACTCGTGCGTCGGCGTGTGGCAGCACGACAGGGTCGAAATCATTGCCAATGACCAGGGCAACCGCACCACGCCGTCGTAC
GTGGCCTTCACCGACTCCGAGCGCCTCATCGGCGACGCTGCCAAGAACCAGGTGGCGATGAACCCCATCAACACCGTCTTCGATGCCAAGCGTCTCATTG
GCCGGAGATTTACCGATTCAACTGTCCAGAGTGACATTAAGCTGTGGCCCTTCAAGGTTGTTGCTGGACCTGGTGACAAGCCTATGATTAATGTCCAGTA
CAAGGGTGAGGAGAAGCAGTTTGCAGCTGAGGAGATATCCTCTATGGTCCTCATCAAGATGCGTGAGATTGCAGAAGCTTTCCTTGGCAGCACTGTGAAG
AATGCTGTTGTCACTGTACCTGCATACTTCAATGACTCGCAGAGGCAGGCTACCAAGGATGCTGGTGTCATTGCTGGCATCAATGTCCTTCGTATCATCA
ACGAGCCAACAGCTGCTGCCATTGCTTATGGTCTTGACAAGAAGGCTTCCAGTGTTGGTGAGAAGAATGTCCTCATCTTTGATCTTGGAGGTGGTACCTT
TGATGTCTCTCTTCTCACCATTGAGGAGGGCATCTTTGAGGTTAAAGCCACAGCTGGTGACACTCATCTTGGTGGTGAGGACTTTGATAACAGGATGGTC
AACCACTTCGTCCAGGAGTTCAAGAGGAAGAACAAGAAGGACATCAGTGGCAACCCGAGAGCTCTTCGGAGGCTGAGGACATCCTGTGAGAGGGCAAAGA
GGACTCTCTCCTCCACTGCACAGACCACCATTGAGATTGACTCGCTGTTTGAGGGCATTGACTTCTACTCCACCATCACCCGGGCCAGGTTTGAGGAGAT
GAACATGGATCTGTTCAGGAAGTGTATGGAGCCTGTGGAGAAGTGTCTCAGGGATGCAAAGATGGACAAGAGCACCGTGCACGATGTTGTCCTTGTTGGT
GGTTCCACTAGGATTCCCAGAGTGCAGCAGCTTCTCCAGGACTTCTTCAATGGCAAGGAGCTTTGCAAGAGCATCAAACCCTGATGAGGCTGTTGCCTAT
GGAGCAGCTGTCCAGGCTGCCATCTTGAGCGGAGAGGGCAACGAGAAGGTCCAGGACCTGCTGCTGTTGGATGTCACTCCTCTTTCCCTTGGTCTGGAGA
CAGCCGGGGGTGTGATGACAGTCTTGATCCCAAGGAACACAACCATCCCCACCAAGAAGGAGCAGGTCTTCTCCACCTACTCGGACAACCAGCCTGGTGT
GCTCATCCAGGTGTACGAGGGTGAGAGGACCAGGACCCGCGACAACAACCTCCTCGGCAAGTTTGAGCTGTCGGGCATCCCTCCTGCACCCAGGGGAGTT
CCCCAGATCACGGTCTGCTTTGACATCGACGCCAATGGTATCCTGAACGTGTCTGCTGAGGACAAGACGACCGGGCAGAAGAACAAGATCACCATCACCA
ACGACAAGGGCAGGCTGAGCAAGGAGGAGATTGAGAAGATGGTCCAGGAGGCTGAGAAGTACAAGTCAGAGGATGAGGAGCACAAGAAGAAGGTGGAGTC
CAAGAACGCCCTGGAGAACTACTCGTACAACATGCGCAACACCATCAAGGACGAGAAGATAGCCTCCAAGCTGCCGGCGGATGACAAGAAGAAGATCGAG
GAGGCCATCGACTCTGCCATCCAGTGGCTGGACACGAACCAGCTCGCTGAGGCCGATGAGTTTGAGGACAAGATGAAGGAGCTGGAGGCCCTGTGCAACC
CCATCATCGCCAAGATGTACCAGGGTGCTGGCGCCGACATGGAGGGCGGAATGGATGACGACACCCCAGCTGCATCTGGCGGTGCTGGACCCAAGATCGA
GGAGGTCGACTAAACGGGTCGATGTTCTCTGGCAGAGGCGGCGAAGCCTGCTGCTTGGTTATTATGGTGTCCTATTGTTATCTGAGACTAGTTGTGGTGG
TTATTGTTTTGGTCCGAGTGGTCGGGGGTTATGCTGTGCGAGTTAAACACTCGGTGGAACATCAGGATTATG
page-top