Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig1997
Contig Information
Length 913 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whkv13m20    rwhkv8n18    rwhkv13m20    rwhkv13n11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 920
Evalue 2.60296e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig1997
TTTTTTTTTTAATATAAAGGTACAGTAGAAATACCAACAAACTAATAATATACTTAGACGTGAGACATCATAACCCTTGATCCACTACCACGAATGTTGC
AACTCGCACGGAATAACTCCGACCACTCGGAAGCAAAACAATAACCACCACAACCTCAAGTCTCAGATAACACAGACACGGTATAATAAGCAGCAGGCTT
CGCCGCCTCTGCAACAGAACAACTGACTGTTTAGTCGACCTCCTCGATCTTGGGGCCAGGGCCGCCGGATGCAGCTGGGGTGTCGTCGTCCATGCCGCCC
TCCATGTCGGCACCAGCACCCTGGTACATCTTGGCGATGATGGGGTTGCACAGGGCCTCCAGCTCCTTCATCTTGTCCTCGAACTCATCCGCCTCAGCGA
GCTGGTTCGTGTCCAGCCATTGGATGGCAGCATCGATGGCATCCTCGATCTTCTTCTTGTCGTCGGCCGGCAGCTTGGAGGCGATCTTCTCGTCCTTGAT
GGTATTGCGCATGTTGTACGAGTAGTTCTCCAGGGCATTCTTGGACTCCGCCTTCTTCTTGTGCTCCTCGTCCTCCGACTTGTACTTCTCAGCCTCCTGG
ACCATCTTCTCGATCTCCTCCTTGCTCAGCCTGCCCTTGTCATTGGTGATGGTGATCTTGTTCTTCTGCCCAGTCGTCTTGTCCTCAGCAGACACGTTCA
GGATACCATTGGCATCGATGTCAAAGCAGACCGTGATCTGGGGAACTCCCCTGGGTGCGGGAGGGATGCCAGACAGCTCGAACTTGCCAAGGAGGTTGTT
GTCACGGGTCCTTGTCCTCTCACCCTCGTACACCTGGATGAGCACACCAGGCTGGTTGTCCGANTANGTGGAGAANACCTGCTCCTTCTTGGTGGGGATG
GGTGGTGTTCCTT
page-top