Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig1983
Contig Information
Length 1107 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whkv2m10    whkv15n06    rwhkv2m10    rwhkv15n06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Unknown protein DS12 from 2D-PAGE of leaf, chloroplastic; Flags: Precursor >gi|187663980|sp|Q0J709|UP12_ORYSJ RecName: Full=Unknown protein DS12 from 2D-PAGE of leaf, chloroplastic; Flags: Precursor
Score 1004
Evalue 6.43518e-107
Total Hit Count 196
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig1983
CCCTCCCCCACCCCACCCCCGGGTTTATTTGATAAGATTTGATCCCAATCCTCGCACGTTTCTTGGCCGAGTGGGGGAGAAGATTCCAGAAATGGCCGTC
GCCGTAGCCGCCGGGACCCTCCGTACCTGTTCCGGCGTATTTCCGGCGGCGTCCGGGAACCATCCGCTTGCCGGGTGGCGGCCACTTGCACCGGCAGCGC
CCGCTAAGCTGAGATTATTGTCTCCAGCTTTGAGGGTTCCTAGAGCTGCTTCGCCTGCAGCTGTTGAGAATGGGAGCTCTAGCAACAGTAATACAGTCCC
TACACCGAAGGTTATAATAGATCAAGACTCAGATCCGGATGCAACTATTGTGGAAGTAACCTTGGGTGACCGTCTTGGAGATCTTCTTGATACTATGAGT
GCCTTGAGGAATTTAGGGCTAAATGTTGTGAAAGCTAGTGTCTGCCTCGATTCTTCTGGCAAGCACAATAAGTTCTCTATAACAAAGTCGTCAACTGGTC
GCAAAATTGATGACCCAGAGTTGTTAGAAGCAGTAAGACTGACAATTATTAACAACATGCTTGAGTATCATCCTGAAGCTAGCAGTCAATTGGCCATGGG
TGCAACTTTTGGGCTAGAGCCCCCTACGGAAGTGGTTGATGTGGACATAGCAACTCACATAGAGATCTATGACGATGGTCCTGAAAGAAGTTTACTTGTT
GTGGAATCAGCTGACCGTCCAGGGTTGTTGGTTGATCTAGTTAAGATCATTGCTGACATCAATATCACTGTCCAATCTGGAGAATTTGACACTGAGGGGC
TACTGGCCAAGGCAAAATTCCATGTCAGTTACCGGGGCAAGCCATTAATCAAGGCTTTGCAACAGGTTCTCGCGAATAGCTTGCGTTATTTCTTGAGGAG
GCCGACAACAGAGGATGCCAGTTTCTAAGCAGATGATTACAAACCCACGCCTTATCATAGCTCATGAGACATGATATTTGTATGAAGTTTGCACTATCAT
CCAAATTATTCCTGAAATATGCATAATTCCCAAAAAAGGGAGGTACACGATATATCATGTACTCATAGTTTCATTTGAAGGCAGCTTCATGCTGTATGAA
CCTGCAC
page-top