Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig1974
Contig Information
Length 692 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whkv5o03    whkv8i12    rwhkv5o03    rwhkv8i12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit nucleoside diphosphate kinase [Lolium perenne]
Score 742
Evalue 6.8556e-77
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig1974
TTTTTTTTTTGCAACTCATATCAAAGCAATACCATATATCAAATATAGAGCAGCAGATACCGCTTGGATGCCCAAGCACAAGGAGATAACTTCAGTTCAC
ACAAACAAGGTTCCCAAGATACAAATCTCAAAACTGTAAACAACCAAAGACTAGTTTGGTAGATGCTTAATGAAACCTGCACTCAACCACTCATGACACA
TCTTAGGCCTCATAGATCCAGTTGTGCTGGCTGCTCCTCCACTCTGCAATGCCCTCAGGGAACCACAGGGCGATCTCCTTCCTCGCACTCTCAACTGAGT
CGCTTCCATGGATGACGTTCCTGCCGATGTCGACGGCAAAGTCACCACGGATGGTGCCGGGCTCAGAGGCCAGGGGGTTGGTGGCGCCAATTATCTTGCG
TCCAGTGGAGACGACGCTCTTGCCCTCCCAGACCATAGCGACGACAGGGCCGGAGACGATGTACTCCACGAGCCCAGCGAAGAAGGGCTTGGAGGACAGA
TCGGCGTAGTGCTGCTCGGCGAACGACTTCTCCACGTTCTGGAGCTTCAGACCTTTGAGGTAGAAGCCCTTCTTCTCGAAGCGGCTGATGACCTCACCGA
TGAGGCCCCTCTGGACGCCATCAGGCTTGATCATGATGAAGGTCTGCTCCGACGCCATTGGTGCTGTGCTAAGCTTGAGATTTCTGATTGGG
page-top