Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig1917
Contig Information
Length 962 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whkv1i14    whkv9i11    rwhkv1i14    rwhkv9i11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative elongation factor 1 beta [Hordeum vulgare subsp. vulgare]
Score 860
Evalue 2.57087e-90
Total Hit Count 427
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig1917
TTTTTTTTTTAGCAACAGGAATCCAACCACATTGTCTCATTTCATACGAAGCAAATAACACTCAGTAGTAATACTACGAATCAACTCGATCTAAGGTCCA
AAAACCTCACAGGGCAGATATGTTATGCTTGCTTTAGCTACGACACCATCACGGCAACAGAAAACTGTAGATATATTGTGCGCCCACCGCCATCACCTGC
CTCAGGAAGATTTAGATTTTGTTGAAGGCAACAATGTCACAGCTCTGGATGTACTCGTTGGCTGGTTCAACGCAGAGATGGTCTTCAATAAGAGTGTCGA
CAGAGACGAGGTCATCAATGATGGTCATCATAATCTGGAGCTTCTTGATGCCATATCCAACGGGCATGAGCTTGGAAGCACCCCACAGAAGGCCCTCCAT
CTTGATGCTTCGGACAGCTTCCTCCAGCTTGACCATGTCGGTCTCATCGTCCCATGGCTTAACATCAAGCAAAACTGATGACTTGCCAGATTCTTTCTTC
TTGGTAGAAGCCTTTGCTTTGGCAGCGCGCTCTTCAGCTGCCTTTTTCTCCTCCTCGGTTTCCTCTCCAAAAAGGTCAACATCGCTGTCATCGTCATCAT
CAGCTGCAGGAGCCTCAGCAACATCAGTAGTTGAGGTTTCAGGGACAACTGATGACAGAACCTTCACACCTTGACCAGGGGCAGTAACTCCACTCAGCTT
CAGGAGTGCATCAATGTGATTGTACCACCTTGCAACATTGGTGCAAGTTGATGGTGGAGCAACTGAGAACTCTGAATACACAGCCAAGTCATCCTTGGAA
GCTTGGTATCCAGAGATGTAACTGCGAGACAGAAGGTAGCCATCAAGCTTTTTAAGGCCTGCCTCAGCATTAACATTGAAGGTAGCCGCCATCTCAGCCT
CAAAAGGATGGAACAGATGATCTACTCGAGGGAGCGAGTCGAGGTGTGGCCGCGGGGAGGCG
page-top