Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig1601
Contig Information
Length 741 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv10n20    whkv2l19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_34186 [Oryza sativa Indica Group]
Score 690
Evalue 8.40341e-71
Total Hit Count 65
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig1601
AATCCGTCCCACATTGATGCGCCCCCTCCCCGCCGACGCGGCGCAGCTGAGCTAGTCGCCGCCCGGAGGCGCCGCAGCGGCTTGAGCCGGCAGCAGTAAG
GCAGTGAGTGAGTGAGGCGACGCGGATAGCGACAGCGGGGTGGTTGGTTGGTGCTGCTGCTCCAAGAACCCTAGAGGAGGGAGCGGGAGGCGGCCGCCAG
GGTTTTCTCGCGCCACAGGCCGCTCCAAAACAGAGATGGTGACAGCCGAAAGCCTACGTGCCGAGCTGTCATCCAAGACGCCACCGTTTGGCCTCAGGCT
GTGGATAGTGATTGGCATCAGCATCTGGGTGGTAATCTTCTGTATACTAGGTTTCATGTGCTTCTGGTCCATTTACCGGAGGAAGCCGAAGAAGTCTGTT
GATAAGATCCCAGTATCTCAAATCCCCGATGTATCAAAGGAGATTGCTGTGGATGAAGTGCGCCAACATGCTGTTGTTGAGAACTACCAAATGCAAGAAA
GCCACACGTTGACGGTGCAGGAGAAACCTCATGAAAAAGATTCTGGGAAAATGCTGGGACACTTGGTCAGGACAAAGTCGAGTGATGCTGATAATTTGAG
CCAGTGCAGCTCGGCCTACCAATGCGATAGGGCTGGTAGTGCTTACTCTGGTGATGAAGGCAGCTCGGGCAACGCTAGGAGGCAATATTCTCAGTATGCG
ACTGTCTCCGCATCTCCTCTTGTTGGTCTCCCGGAATTTTC
page-top