Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig1528
Contig Information
Length 787 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhkv1i21    rwhkv11l18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit meiosis 5 [Zea mays]
Score 540
Evalue 2.33967e-53
Total Hit Count 56
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig1528
AGATAGTGATATTACATGATAAAACAACAAAAATAAAAGAAATATATCAAGCCACAAGATAGCATCAATCAAGAAAAATGCGCGGGAGGAAGAAATTTAG
CCAAGAAACACCGATGACTGAAACTAGTAGTGGAATTCATTTGCCTTCTTGAAAACCCCAGCTTGGGCAGAAGCAGCACCATCAGAGGTCACGGCCACGA
CGATACAGTCCTTCACCTGCTGGGTGGTAAATGGGAACTTCTTGTTCACAATGGAGTTGAGGTATGCAGCTGCCCCCTCACGTATCAGGGCGCCAATACC
ATCAGTTCTAGTGTTTGAGAGTGCATCATGCATATTTCCTAGCTTCTTGCCACCTATCATACTGCATGCAGCACCAAATGTCTTGCCGATGTTGCCGAGG
GACCCAATAGCTGCAACTATAGCATCTGGGTGATTCTTCCAGTAGTCGCAGGATCCAATGAACCCATGCTTCTTTGGACTTGCAGGGACATCATGGGAAG
GTGCACTTGGGGTGCTCGGTGTAGTGCCATAAGATGGCGTCGGTGTAGTGCCGTAAGATGGCGTCGGTGTAGTGCCGTAAGTTGGCGTCGGTGTAATGCC
GTAAGTTGGTGTCGGTGTAGTGCCGTAAGATGGCGTCGGTGTAGTGCCGTAAGTTGGTGTCGGTGTCANTGTCNGGTTGTANCCTCCTCCTGACCCATGC
NTGGGAGTTGGTGAGCCCCCATANNGGGTCTTCTGCTCNTGCNACTCTCCCANGCTCCTGCNCNANCTCNNTGAAACANCCCCNCCA
page-top