Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig99
Contig Information
Length 1030 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh18d18    rwhsh18d18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_012436 [Oryza sativa (japonica cultivar-group)]
Score 215
Evalue 1.76489e-15
Total Hit Count 181
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig99
CGAGGCTTCGCCGCTCCCTCTCACCCGCGTCGCCTGCACCAGCGAGGTCGCCACAAGATTGTTTTTGTTACCAAAGCGGAGGCGAGGAGCAGCTGGTGAG
TTGTACCCATGGCTGGATCTGAAGTGTCTGGACGTCCCCGCGATGAGGATGAGTGGGAGGAGCAAGAGCACATCTGAAGATGGTGAGGAGTGGAGGCGGC
GGTTCTGAATTTGAAGATGGTGCTGTGAGGAGTAGCGGGAGGAGCAGTCGTCGACGGCCTGGCTGCATGGGGTACGCCCTCCCCTTCGTCTCCTACGGCA
TCGTGGACATCCTGCTCGACGACGTACATCTGCTCGAGGATATCCTGCTCGACGATGCTCCTCTTCGCCAGCATCTCTAGCGCGTGACTGATACAGAAGC
AAAGTGTTTCAAGGCACATAGGTCCAGTGATGAGAGTGGTAGTTTCAGAAAAGATACTGAAGCTAATTCAAGAAATACTACTAAGGCTGTTGGTCAAAAT
CCCCCACCACCAAAGCAAGGTTTCATCCATGTGAGGGCAAGAAGGGGTCAAGCAACTGACAGCCATAGCCTTGCAGAAACGGCAGATGAAGGCCGTCGAA
GATCACAAGCGCAGCTTGCTATTGTACAGGTTTAGAATTTAGAAAGGTGACCTATTTTTTCATGTGAACTTACCTATTCTTTGCTATTCAGAATGATTAT
TTATCTTCCCATTGCTGTGTTAATTGATTCATATGCGGTTCTGCTATTCTGACAAGGATATCCATCAAGGTTATTTGGAGGGACATAATGAAACGTCACA
AGTTCTACTTTGCTGATTCTTTCAGAGAATTGTTTCATTACAAATGCGCTGTCGCGGACATGTATTAATCCCAAATTCCAAATCACTCTGGAATCCAGTC
AAAATCCAGTCAAAATCACTCTGGAATCCTTCTCCGTAATTGATTCGCAAACTACTCTCAAGGACTGCTCTGAACCTCAAATATCGTGGGCACATGAAGT
TGTGGTGTGATTTTTACAGAAACAAGTGAT
page-top