Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig97
Contig Information
Length 419 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh18e10    rwhsh18e10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glycosyltransferase, MGT family [Chthoniobacter flavus Ellin428] >gi|196225408|gb|EDY19916.1| glycosyltransferase, MGT family [Chthoniobacter flavus Ellin428]
Score 81
Evalue 1.1945
Total Hit Count 5
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig97
GAGGCGTGATTTTTGTTGGTTGCTGAGAAGAGTTCGACGCTGCTCAACATTTTTGCCTCAAAAATAAAAAGTCTGACGCCTACCAATTCTCCTACTGAGG
CTCCTATGAACGGCCGATCGTCAATTTGAGGATATTCGTGTTGAGGCTGCAAAGAAGAGGCACCGTGCCACCAAGAGTCTGTATGGTCTCGCTGTTCTAC
GCTATTGACGACCATACCACCGTCTATGCATAGAATCCATGTGCCGTGTTTCCTGTTTCTCCAAGGCCTTTTAATTCTGCCATATGATGTGAGGAAATAT
GCCTCTGCTTTATTATCTATATCATAGTTCATGTAACCTCTAAAGATCCAGTCCTTGAATGTGTTGTATTCGCACAACTGTCTTATTGTTTCAGTTAGAA
ACTTCTCTGANNAAAAAAA
page-top