Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig96
Contig Information
Length 263 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh10g11    whsh10g11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Ostreococcus tauri] (no hit)
Score 85
Evalue 0.4255
Total Hit Count 0
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig96
GGAGAGAACTAGGTCTCGCGGGTTCAAGTTAGCTACTCGGTGTCATTTGGTTTGTACATTTGCTGTATATGTGTTCAGGTCATATTGGTGATATTGTTTA
ATTTTAGTTGTCGGTCGGCACATGTGTATTCTTAAGAGATGGTAGAGCATAATTGCTGTAAATGATTTGCTTCAACCAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGGGGGGGG
page-top