Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig94
Contig Information
Length 567 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh10b12    rwhsh10b12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative chloroplast chlorophyll a/b binding protein [Solanum nigrum]
Score 672
Evalue 5.55109e-69
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig94
CGGCACGAGGCTTCAGCGAGGGTGGGTTGGACTACCTCGGCAACCCCAGCCTCGTCCACGCGCAGAGCATCCTCGCCATCTGGGCCTGCCAGGTCGTGCT
CATGGGCGCCGTCGAGGGGTACCGCGTTGCCGGTGGCCCGCTCGGTGAGATCGTCGATCCCCTCTACCCCGGCGGTAGCTTCGACCCCCTTGGGTTGGCT
GATGACCCTGAGGCATTTGCGGAGCTCAAGGTGAAGGAGATCAAGAATGGACGGCTCGCCATGTTCTCCATGTTTGGCTTCTTCGTCCAGGCCATCATCA
CCGGCAAGGGTCCCCTTGAGAACCTTGCCGACCACCTCGCCGATCCCGTCAACAACAACGCCTGGGCATTCGCCACCAACTTCGTCCCCGGCAAGTGAAT
ATGAGGCGATGCCCTGTGGGACTTGGGATGCATGGAACAAACATGGGTTGTGTGAAACAAAACAACCGCTACCGCGGCTTGTTTTTTCACCTGTATGATT
ATTCGTCCGATGAGGACATGTAACAGTATTTGATTGGTTTATCAAACAAGAATGATGGTAAACTTCC
page-top