Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig91
Contig Information
Length 438 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh10g05    whsh10g05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Paramecium tetraurelia strain d4-2] >gi|124397152|emb|CAK62659.1| unnamed protein product [Paramecium tetraurelia]
Score 75
Evalue 5.94535
Total Hit Count 2
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig91
GCTGAGACGCTGAAACTCGCTGCCCCGGTGCCATGATTAGCTGAGTACTCCATGGGAGTGTGGACTGCTCTTACCAATGTTTTATATTTTGGTCGTTGAA
GATTTTTCATGTTGGGAATGATCGACTGTGGCAACTAAATACTCGAAGACCCCATTTGGAACTCTGGAAGTTGCTCCTACATCTGCTGGAAAATGGACCA
ATTGATGCGAAACAGAAATGGCATGTGATTTCAGTTCTGTTCTTTTGGTAGGAATGGGTTGGCGGAAACCCTTTCCGTCTTCCAGTTCCACCTCATATAT
CTTATGTAATTTTTTGTTGATTAACGCATGCTAGAGTTTTTTTTTCCGAAACGGAGACAAAAGATTTGCCTCATCTATTAAATGAGAAGGATAGAGTTTT
GGAGTGTTACACATGCTAGAGTTTGAACNAAAAAAAAA
page-top