Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig90
Contig Information
Length 348 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh10f24    rwhsh10f24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit conserved hypothetical protein [uncultured proteobacterium QS1]
Score 77
Evalue 3.56331
Total Hit Count 2
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig90
TCGGCACGAGGCGTGTCTGGGATCATTACACTGCATGGGTTGGTCTCCGCTGGATTGTAACCAATTCTTTGTGTAGCCTGCCCTGGTTCTTTGTGGTTCT
TTGCGTCTGCTTGGTCCTCCCAAGACGTCAGATAAATTCTTGTGAATCTGATCGACATCGTCTTATCACTGTTGTAGCATCTCTAGTGATATTTGAAGAG
TATGCGTTGGAAGACACTACCCCCAGCACCACACCATAGCCCCTTTGTATAGTGTTTTGTTAGAGGAATATGTGGGACCTTGCTTGTTGGTTGTTCGAGT
GGAGTTCTTTTTGAAGTGAAATAAATCTTGAGTTGCCCAAAAAAAAAA
page-top