Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig89
Contig Information
Length 151 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh18g09    rwhsh18g09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_15668 [Oryza sativa Indica Group] (no hit)
Score 74
Evalue 7.75041
Total Hit Count 0
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig89
GTATTAGCTGGCTTTTGTTTTACAATGAAGAAAAAAAATGTATTTTTGAGTTTGCTCAGACGCGTAGCAGTATGATGTGGGGATACTTGTGATTGGTTCG
GTGTCAAATAATTAGGAAATGAAATATGGATTTTTCGTTGGAAAAAAAAAA
page-top