Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig88
Contig Information
Length 251 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh1j20    whsh1j20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_15668 [Oryza sativa Indica Group]
Score 74
Evalue 7.75041
Total Hit Count 1
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig88
GAGAAGCTGCTCTTCGGCAGAGGATAGATAGCCGCGGCTTGGAGACGGTCCTCTTCGCTTCATCTTCAACTCCTCTCTGTTTGACCGTTGCAATGTCTGC
TGGCCATTGCATCACTTGTGTATTTATCTTTGGGTGTGATCTTAGTTTGTATGGTATCATCAATTGCGTCGTGGTGTAATTTGTGATTGTTTTGTGAGAT
ACTTGGGTGTACTGTATAAAGATGGAGTAGTCTTTTCGTGCNAAAAAAAAA
page-top