Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig86
Contig Information
Length 172 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh18i04    whsh18i04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] (no hit)
Score 365
Evalue 1.88682e-33
Total Hit Count 0
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig86
GATCAAGTGAAGCTATCTAAGAGTATGCTTATGTGGAACTATATAAGTTCCTTATCTCGCTGCCGCTATGGCTTGCTGTTGCTATGTAATAAGTATGATG
TTTGCATCTCACTTTACTCGCTTTTGGAATAAAATATATATTTGCATTTCCCATGAAATTCCAAAAAAAAAA
page-top