Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig85
Contig Information
Length 536 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh18m09    rwhsh18m09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 365
Evalue 1.88682e-33
Total Hit Count 254
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig85
GAGGCTGAGATTGAGGTTTATTGTGAAGGCGAACTAATCAAGGTTACACTATCTGGGAACCAACAACCTATAAATGTTGAAATAACGGAAGCTGCAATGG
AGTTGGGCGCTGAAAAAGTCTCCGAGCTGGTCAATGAAGCCTACAAGGATGCACACCAGAGGAGCGTTCAGGCCATGAAGGAAAGGATGGCTGATCTAGC
GCAGAGCATAGGAATGCCTGCAGGGCTCGGCGACGGTCTCAAGTGATAAAAGGCCTGGTACTTGAATGCTTTCCAATAATGAAAGAAGCGTCTCTCAATT
TTGTATTCTAGCTGTGTCGAGTCATGGTTAAACCCCTCTGCAGCATCGGTTAGCTGTGCACGAGCTGTAACTGTGGACACCTGTTTCCTTGCTCATTTGC
ACATCATAGTTACAGCATTAGTTCTAATGTGTTGTTTTACACCAAACAGATGTTGCTTTTGTGCTAGTAGACCGGCAGCCTGGAGAACATTTGTAAACTA
ATAACTGCAGAGTGAAATATGTTTATGTTGCGAAAA
page-top