Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig83
Contig Information
Length 454 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh8p04    rwhsh8p04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 194
Evalue 9.54461e-14
Total Hit Count 31
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig83
CGGCACGAGGATGGGTTTCATCCAGAGCACCTTCTCGCTCCTTGTCGGCGCGGCGGGCGGCATCTACATCGCCCAGAACTACGACGTCCCCAACATCAAG
AACTACATGCAGGGCCTGATGGGCAAGGCCAAGGAGCTGGACCATGCCTACAAGAAGCCCGAGGATGGCAGCAAGAACAAGGCTTAGTCAGCCCGCTCCC
CCACCCCTCCATTAGAGCATGACCGACCGCTTAGCATGCTAATTGTTATTACTATCACTTAGTAGGTTCACTATATATCATTTGAGCAATGACTCTGTCC
ACTCCGTTTTAAGACTCTGTCCTGGGGATGAAATTTAGTAGATGATGGCGGCACGTTTGTGAATGAACGAATTAATGGATGAAATGACCTGTTAGACTGC
GTGATTCATGACGTTTTTGAGGAGCCATTTTCCGTTTGACTTGCNAAAAAAAAA
page-top