Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig81
Contig Information
Length 208 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh18o04    rwhsh18o04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit sulfate adenylyltransferase subunit 1 [Cellulophaga sp. MED134] >gi|85816501|gb|EAQ37689.1| sulfate adenylyltransferase subunit 1 [Dokdonia donghaensis MED134]
Score 78
Evalue 2.69598
Total Hit Count 1
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig81
GGCAGATGCCTATGTGCTTTCGATTGCTTAGGCTGTATCACTGTATGCATAGGGAACCTGGCACCTATGTTGTCTAGCTCTACCGATGAGCCGGCCAGTG
CTTCTAAAATATGTCTGTTTTTTCTCACCTTCTCGTGTTACATTCCGTGTGACTCCTGAATTAAGTTTTAGTTATTCCAGCTGAGTATTTTTGGGACGAA
AAAAAAAA
page-top