Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig78
Contig Information
Length 386 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh1f19    whsh1f19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit enolase; phosphopyruvate hydratase [Escherichia coli]
Score 511
Evalue 5.44384e-53
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig78
AAGCTGCGCAGTCCATCGCCAGAGTGATGTCTTTGCCCAAGTTCATAACCAGCAGCTTTAACAGCTTCAGCGATAACAGCCAGAGCTTCAGCGTTGGAAC
CCAGGTTCGGCGCATAGCCACCTTCGTCACCAACAGCAGTGTTCATGCCTTTCGCTTTCAGAACTTTTGCCAGGTGATGGAAAACTTCAGAACCCATGCG
GATGGCTTCTTTCACAGTTTTCGCGCCAACCGGCTGAATCATGAATTCCTGGATATCAACGTTGTTGTCAGCGTGCTCACCACCGTTGATGATGTTCATC
ATCGGAACCGGCATAGAGTATTTGCCCGGAGTACCGTTCAGTTCAGCGATGTGCTCGTACAGCGGCATACCTTTGGGGGGGCCCGG
page-top