Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMV_all.Contig827
Contig Information
Length 747 bp
Tissue Shoot grown with continuous light after cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkv5j13    rwhkv5j13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|396134|emb|CAA80666.1| protein synthesis elongation factor-1 alpha [Hordeum vulgare subsp. vulgare]
Score 832
Evalue 2.88625e-87
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMV_all.Contig827
GCCTGACCACTGAGGTGAAGTCCGTTGAGATGCACCATGAGTCTCTCCTGGAGGCGCTTCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGGCTGT
CAAGGATCTCAAGCGTGGGTACGTCGCTTCCAACTCCAAGGACGACCCTGCCAAGGAGGCTGCCAACTTCACCGCCCAGGTCATCATCATGAACCACCCC
GGCCAGATCAGCAACGGCTATGCCCCGGTGCTGGACTGCCATACGTCCCACATTGCTGTCAAGTTTGCTGAGATCCAGACCAAGATCGACCGGCGGTCTG
GCAAGGAGATTGAGGCGGCGCCCAAGTTCCTCAAGAACGGTGATGCTGGGTTCGTCAAGATGATCCCCACCAAGCCCATGGTGGTGGAGACCTTTGCCCA
GTACCCTCCCCTGGGCCGCTTTGCTGTGCGTGACATGAGGCAGACGGTTGCCGTGGGTGTTATCAAGGCTGTGGAGAAGAAGGATCCGACCGGTGCCAAG
GTGACCAAGGCTGCGGCCAAGAAGAAATGAGATGGTGTCAGGTTCTTTACTGCATCTATGGTGGCGGTGGCGGTATTTGGTGGTGGTGATAGTTGTTCTA
GTTGTTTTGGAAACTTGTTAAGCTTCGGTTATTTGTGTCGAGCAGTGTTGGAACTGCTTATTGCTCTGTCATTGTATCGTTCGGTTGTGTTGGTGAAACT
TCGTCAGTTAATGTTGCTACTATATATAGTTGGCATGTTGGAGTCGT
page-top