Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig76
Contig Information
Length 251 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh18o05    whsh18o05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Thioredoxin M-type, chloroplastic; Short=Trx-M; Flags: Precursor >gi|4138592|emb|CAA06735.1| thioredoxin M [Triticum aestivum] >gi|56709480|emb|CAI35908.1| thioredoxin M precursor [Triticum turgidum subsp. durum]
Score 111
Evalue 0.000397127
Total Hit Count 13
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig76
GGGAGAGCGTCATCGGCGCCGTCCCGAAGACAACCCTCTGCACCATAATCGACAAGTACATCGGCAGCTAATTAATCATTCTTAATTAGCGATTAATCGA
GGACGCACACACCTTTACTGTTCTGTTCGCGAGACAGCATATATGTATGTATATGATGCGCGTATACGATCCACCGACCAGTTGTGACTTGTACTATTCT
TAATTCTGATGCAAATCAAAACTGATTTATTCGGGCACGTCAAAAAAAAAA
page-top