Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig75
Contig Information
Length 146 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsh10d20    whsh10d20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_05919 [Oryza sativa Indica Group]
Score 235
Evalue 1.72203e-18
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig75
GAAAGAACTTATACCTCGGCAAATGTTTAAAATACCTATTCAAGCATGTATTGGTGCAAAGGTCATTGCAAGCGAAGCCCTATCAGCCATCAGGAAGGAT
GTCTTGTCAAAATGCTACGGGGGTGATATATCAAGGAAAAAAAAAA
page-top