Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig74
Contig Information
Length 510 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh10d13    rwhsh10d13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0152200 [Oryza sativa (japonica cultivar-group)] >gi|3618316|dbj|BAA33204.1| zinc finger protein [Oryza sativa Japonica Group] >gi|55296631|dbj|BAD69333.1| zinc-finger protein R2931 [Oryza sativa Japonica Group] >gi|55297284|dbj|BAD69069.1| zinc-finger protein R2931 [Oryza sativa Japonica Group] >gi|113594874|dbj|BAF18748.1| Os06g0152200 [Oryza sativa (japonica cultivar-group)] >gi|125554117|gb|EAY99722.1| hypothetical protein OsI_21707 [Oryza sativa Indica Group] >gi|125596076|gb|EAZ35856.1| hypothetical protein OsJ_019339 [Oryza sativa (japonica cultivar-group)] >gi|215678973|dbj|BAG96403.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215701456|dbj|BAG92880.1| unnamed protein product [Oryza sativa Japonica Group]
Score 171
Evalue 5.13465e-11
Total Hit Count 13
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig74
GAGGCCGAGGTTCCCTCCCCACCAACAGCCTCGGGTCTCTGCTGGCAAGGGAACTTGCATTACCCTGTGTACGACGGCGCCATGTTCGTCCCTGAAGCAC
CCTCCCTGCAGAGCTCCCAGGACAACTTCGCTGCATCTGCTGGTTTCAAGCGTCGAAGGAGAGAGTTTTGAATACCCGAAAGAATATAGCGTTGGACATA
TCTGTCAAACAGGGGATCTTGCTGTGGGTCTCTTGGTGGGCCAAATCGCATAGACAATCATTCAAATGGATGGGTTCTTCGCTGGTCGGTCAAAAAGTAT
ATGTTGTAATTGTACGCCTTTTTTGGGTCTTGTTGCCAAAGATCATGGTTATTGAGTTGTGAGCTCTGAGATAACAGGTTTGTGTATAGTGAAATAAAGA
GGAGCGTCGTCAACACCATGTACTATATAGGCTTTGAAATTCCATTAAGATGCATCAGAAATCAATGTTGGATTTGTGTGATTCGATTCGCATGAACTTT
AAAAAAAAAA
page-top