Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsh_all.Contig73
Contig Information
Length 775 bp
Tissue -
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsh10d03    rwhsh10d03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0567000 [Oryza sativa (japonica cultivar-group)] >gi|113624514|dbj|BAF24459.1| Os08g0567000 [Oryza sativa (japonica cultivar-group)] >gi|215694414|dbj|BAG89407.1| unnamed protein product [Oryza sativa Japonica Group]
Score 595
Evalue 9.42988e-60
Total Hit Count 26
Registered year
Contig Sequence     [ Download ]
>whsh_all.Contig73
TTCTCAAAACCATCAAAAGGGGTATTCAGGTTCATGAAGATTTCTCAGGAGGCATCGTGAGCCCTGCAGAGTTATTAGTATGCCGCTTCACGGGCATTAA
GGCTCTGGAAGATGAATATGGTTCTGCAGAAATTGTTAAGCAGGGAGCTGAAGTAGTTCAGACAGCTCTCACCAAAGCATTTGATCAATTGCAGGGAGCA
TATAACGGGAAAATTGTTGGGCTGGTAATATCCACTAAGGAGGCTTCAACATCCTTGGCATCCATCATCGATGGACCATCTTCATTGCATATCTCAAGAC
GGCTTGCAGAAGCATCGAAAACTAATGCTACAGCTTCTATAGCTGCTATATATCTTGTTAGATTGAGTCTTGCATGGATTACAGGGATCATCCTCCTTGT
CTCAACTCTCATTGGGATCTGCCTGCTCATGAACATGCCGCTTACCAGGGACACGCTCCTATATTCAAATGTCAAGATGGATTAGTTTTACATATGAATT
TTCGCACGATGGCATGGAAGTTTTCAATAGTCATGCTTGGTTTTTTCCTTTGGACCTTGGGTTTACAGTAGGGACGCTGAGTGTGGGCTTGCTGTTCACC
CACCACCCAGTGTAGCATAAAAATACTGTTGCTATGTGAACCGTTCATCTAGAATTGTACTGCCATTGCCTGCATGGGCTTCTCTCATTTTCCCGTAAAT
AAATAAAAAACAATCGAGAGGAGTGTATTTTGTTAATATCAGCGAAGATTGTACTCTATTGTTGTAAAAACCCAG
page-top